Microbiology 101 What Have I Learned
Instructions: After you have studied the material take the following
exam, giving yourself 1 minute per question to
mimic the conditions of the actual exam. Jump to the answer page and grade your exam on a
percent basis as described in the syllabus. The format of these questions may not always
match the actual exam format because of the constraints on the answer sheets, but the
information requested will be of the same quality. I will probably be converting all the
Multiple Choice/True-False/Matching questions to the computer generated exams over
the next few weeks (starting Nov. 17, 1998).
ESSAY QUESTIONS
The essay questions are for those students who
want to obtain a grade of B or better and/or who wish to really understand the material
(e.g. nursing, Civil Engineering etc.). This method of study requires the following:
- That you begin at least a week to 10 days before
the exam.
- That you write
out the answers as completely and in good quality English; i.e., in a
form to be published.
- That you grade your answer honestly.
- That you retake any question you didn't score 95%
or above until you reach that level.
REVISED: 10/22/99
TABLE OF CONTENTS
CHAPTER 1 QUESTIONS
Match the following names of individuals with the descriptions (1-10)
below of their contribution to the science of Microbiology. A name may be used more than
once, or not at all:
- A. Leeuwenhoek
- B. Hooke
- C. Semmelweiss
- D. Redi
- E. Pasteur
- F. Koch
- G. Hesse
- H. Jenner
- I. Ehrlich
- Recognized the relationship between Cowpox and immunity to Smallpox.
- Is credited with suggesting the use of Agar as a solidifying agent of microbial media.
- Discovered the first cure for syphilis.
- First one to see and draw bacteria and a whole host of other microbes.
- His work lead to the concept of a "Magic Bullet" to fight disease.
- Discovered the bacterial agent that causes anthrax.
- First person to relate the spread of puerperal sepsis to unsanitary conditions in a
hospital.
- Performed a crucial experiment proving that larger life forms did not arise
spontaneously.
- Person who was responsible for developing most of the basic microbiology laboratory
techniques used today to study microbes.
- Person who is considered responsible for initiating Modern Immunology.
- Which of the following does NOT describe one of Koch's Postulates:
- A. Grow the agent in pure culture.
- B. Isolate the same agent from a new victim
- C. Isolate the suspected agent from a disease victim
- D. Characterize the Gram staining characteristic of the isolated agent
- E. Infect a health host with the agent and produce the same disease
- Which of these descriptions is NOT a characteristic of AGAR.
- A. An excellent food material for many different microbes
- B. Melts only at 100oC
- C. Stable to sterilization temperature
- D. Toxic to many microbes
- E. Solidifies at 45oC
- Salvarsan is:
- A. A common stain used to visualize microbes
- B. The first cure for a STD
- C. A type of bacterial spore that is resistant to heat
- D. The microbiologist that developed the Pasteurization of milk
- E. A type of blood cell
- Pasteur used his knowledge of immunology to immunize his daughters against Typhoid
Fever: True or False.
- The person described in question #7 received a Nobel Prize for his contribution to
medicine: True or False.
Click here for the
answers to these questions.
ACROSS
- First person to see microbes.
- Suggested use of solidifying agent for media.
- First person to see bacteria.
- Provided energy for formation of organic molecules during the early period of
earth’s history.
- Nickname for a physician or PhD.
- Disproved spontaneous generation of bacteria.
- The first viral disease for which a vaccine was manufactured.
- A common bacterial shape.
- The multicellular organism used to disprove spontaneous generation.
- First person to insist that doctors cleaned up before dealing with patients.
- A common bacterial pathogens of women who have recently given birth.
- First identified bacterial pathogen.
- Chemicals that make up the interior of the cytoplasmic membrane.
- First true cell on earth.
- Discovered the first "Magic Bullet" to treat a disease.
- A form of bacteria that caused problems with disproving spontaneous generation.
- Proto-cellular structure
|
DOWN
- Carries bubonic plague bacillus
- Person who discovered smallpox vaccine.
- Defined the steps for proving that an organism causes a particular disease.
- A ________ culture contains only one type of organism.
- Solidifying agent used in making media.
- Disproved the spontaneous generation of Eukaryotes.
- First person immunized against rabies.
- First human food to be shown to be made by the metabolism of microbes.
- City where bacteria were first seen.
- First disease cured by a chemotheraputic agent.
- Organic _______ in which first life evolved.
- Shunned by their fellow men for centuries.
- Estimated age of earth in billions of years.
|
Answer will be posted a week before the exam.
CHAPTER 2 QUESTIONS
- Match the following descriptions of cells (1-10)
with:
- A. Eukaryotic cells only
- B. Prokaryotic cells only
- C. Both
- Contain both RNA and DNA
- Contain organelles
- Are generally the smaller of the two categories of
cells
- Are highly regulated
- Are considered "primitive" cells
- Majority of DNA contained within a membrane within
the cell
- Contain mitochondria
- Formed by the merging of other cells
- Contain photosynthetic forms
- Flagella composed of several filaments
11. Chromosomes are:
- A. Multiple units of genes in linear chains
- B. A newly discovered very large eukaryote
- C. A type of virus that attacks only prokaryotic
cells
- D. A type of organelle that secretes material
- E. Another name for a common yeast
12. Prokaryotic cells generally range is size:
- A. From 2 to 100 micrometers
- B. From 100 to 1000 micrometers
- C. From 0.5 to 2 micrometers
- D. From 2 to 35 micrometers
- E. Greater than 600 micrometers
13. Prokaryotic cells never communicate between
each other, but live their lives as independent cells: True or False.
14. Red blood cells lack a nucleus: True or
False.
15. Which of the following descriptions fit the
ARCHAEBACTERIA:
- A. They are almost all pathogenic.
- B. They are found in water saturated with table
salt.
- C. They metabolize (eat) things like methane and
hydrogen gas
- D. They are rare in nature
- E. They are often found in environments where the
temperature is greater than 100oC.
Click here for the answers to these
questions.
Identify the structures A-F in this figure. Answer
CHAPTER 3 QUESTIONS
The Gram negative and Gram positive cell walls
differ by a number of characteristics. Identify which characteristic is associated with
which type of cell wall.
A. Gram negative.
B. Gram positive.
1. Has an outer membrane. _______.
2. Has a very thin shape-forming layer. _______
3. Contains LPS or lipopolysaccharide. _______
4. Stains red upon carrying out the gram-stain
procedure. _______.
5. The bacterial capsule is:
A. A form of storage granule within the cell.
B. Is a long thin protein rod that is used for attachment.
C. A coating on the exterior of many cells.
D. Is a long thin protein rod that is used for bacterial exchange of genetic material.
E. Always present on a cell that has the ability to form a capsule.
6. A pili is:
A. A form of storage granule within the cell.
B. Is a long thin protein rod that is used for adhesion.
C. Generally composed of sugars.
D. Is a long thin protein rod that is used for bacterial exchange of genetic material.
E. Always present on a cell that has the ability to form a capsule.
7. CRITICAL THINKING QUESTION: Bacteria can be
said to have a NOSE because:
A. They have a special STRUCTURE on one end or
side of the cell that contains a primitive "brain" to process odors.
B. Their flagella have special detectors in them that help a bacterium move towards
desirable chemicals and away from undesirable ones.
C. The pili act as chemical detector systems.
D. The presence of a capsule blocks a bacteria's ability to detect chemicals.
E. They are able to detect chemicals and to move towards desirable ones and away from
harmful ones.
8. Bacterial spores are able to survive for many
years without any measurable metabolic activity.
A. True
B. False
9. The faculty member in our department who is
working on the intestinal pathogen Campylobacter is:
A. Hurlbert
B. Spence
C. Kahn
D. Konkel
E. Postle
10.Which of the following materials is NOT a
bacterial storage granule:
A. Sulfur
B. Glycogen
C. Phosphorous
D. Ribosomes
E. PHB
11. The average size (molecular weight) of an
enzyme is:
A. 40,000
B. 1,000,000
C. 20
D. 1,000
E. 5,000
12. The phosphate end of a phospholipid is
(chemically):
A. Hydrolymphatic
B. Hydrogen
C. Hydrophobic
D. Hydrophilic
E. Hyperphilic
13. Water can pass freely through the cytoplasmic
membrane.
14. The proteins in the cytoplasmic membrane do
which of the following: If only one of A-C is correct chose it, otherwise chose either D
or E.
A. Make all the proteins in the cell.
B. Act as the sensors of the cells.
C. Regulate the flow of material into and out of a cell.
D. Both B & C
E. Both A & C
15. Some bacteria contains tiny magnets that
allow them to follow the magnetic lines of force.
A. True
B. False
Click here for the answers to these
questions.
Identify/describe in as much detail as possible each of the above spore
types. For the answer click here.
Identify all the components of a generalized cell. Answer
Identify the components A-C and the two types of bacterial cells D &
E represented by this cartoon. Answer
CHAPTER 4 QUESTIONS
1. The place where a bacterium optimally
flourishes is called (scientific term) it's:
- A. Niche
B. Home
C. Maximum environment
D. Ecosystem
E. Environment
2. Termites contain many microbes in their gut.
What do these microbes do there
- A. They are accidental inhabitants of the termite
gut.
B. They produce antibiotics that protect the termites from termite pathogens.
C. They produce gases that are released into the termite nest that keep away predators.
D. The produce hormones necessary for the termites to survive.
E. They convert the plant material the termites chew up into termite food.
3. CRITICAL THINKING QUESTION: When deer and elk
are moved from one area to another several hundred miles away, they frequently die even
though there is sufficient grass and water for them. Why does this happen?
- A. These animals depend upon the microbes in their
gut to digest the grasses they eat, but different grasses in different places can't be
used by their gut microbes, so the animals starve.
B. All of these animals carry latent pathogens which the stress of moving activate,
leading to disease and death.
C. The new areas contain pathogens that these animals are not immune to so they succumb
rapidly to them.
D. The nutrient content of the grasses from one area can not meet the needs of the animals
born and raised in another region with different grass species.
E. The differences in climate, even though slight are enough to kill the animals that have
become adapted to a particular climate.
4. A bacterium that grows best at a temperature
of between 0oC and 10oC is called a:
- A. Mesophile
B. Thermophile
C. Halophile
D. Psychrophile
E. Photophile
5. The "suffix" -PHILE means:
- A. To "grow"
B. To "like"
C. To "be motile"
D. To "live in water"
E. To "require high temperatures"
6. The oxygen in the air is lethal to:
- A. Obligate thermophiles
B. Photosynthetic microbes
C. Microaerophilic microbes
D. Obligate anaerobes
E. Aerobic microbes
7. A neutrophile is:
- A. An organism that lives optimally in an
environment that is 80oC or greater.
B. An organism that lives optimally in an environment that is pH 7.0.
C. An organism that lives optimally in an environment that is rich in the element nutrium.
D. An organism that lives optimally in an environment that is lacking light.
E. An organism that lives optimally in an environment that is lacking nitrogen.
8. Which of the following chemicals can bacteria
NOT use as an energy source:
- A. Zinc
B. Sulfur
C. Gasoline
D. Aviation fuel
E. Turkey feathers
9. CRITICAL THINKING QUESTION: You have isolated
a bacterium from a high mountain stream. Your first guess as to its nutrient requirements
are that it is:
- A. Nutritionally fastidious
B. Not Nutritionally fastidious
10. Which one of the following is a TRACE
ELEMENT:
- A. Nitrogen
B. Oxygen
C. Carbon
D. Zinc
E. Hydrogen
Click here for the answers to these
questions.
Identify the oxygen requirement characteristics of the bacteria in these
4 tubes as indicated by their pattern of growth. For the answer click here.
Identify (name) the groups of bacteria that grow opimally within the
temperatures ranges (in Co) indicated by the bars A-D. Answer.
Identify (name) the groups of bacteria that grow opimally within the pH
ranges indicated by graphs A-C. Answer.
CHAPTER 5 QUESTIONS
Match the chemical descriptions below with the
types of biological molecules. An answer can be used once, multiple times or not at all.
- A. Polysaccharides
B. Nucleic acids
C. Proteins
D. Lipids
E. Phospholipids
1. Biological polymers composed of chains of
amino acids. _______.
2. Biological polymers composed of sugar, bases,
and phosphate. _______.
3. Biological polymers made of sugar subunits.
_______.
4. Biological polymers formed with peptide bonds.
_______.
5. A DNA molecule does NOT contain the following:
- A. Uracil
B. Cytosine
C. Adenine
D. Thymine
E. Ribose
6. A RNA molecule does NOT contain the following:
- A. Cytosine
B. Adenine
C. Thymine
D. Ribose
E. Deoxyribose
Atoms contain the following components:
- A. Electrons
B. Protons
C. Neutrons
Match these components with the following
descriptions (7-11). An answer can be used once, multiple times or not at all.:
7. Positive charge ______
8. No charge ______
9. Negative charge _____
10. Resides in the nucleus of atoms _____
11. Orbits around the nucleus of atoms _____
Molecules are held together by a variety of
chemical bonds listed below. An answer can be used once, multiple times or not at all.:
- A. Covalent bonds
B. Hydrogen bonds
C Ionic bonds
Match these bonds with the appropriate
description given below (12-17):
12.Weak bonds between polar molecules. ______
13. Bonds formed between positive and negative
charged atoms. _____
14. Bonds important in biology because they allow
flexibility. _____
15. When you dissolve table salt in water these
are the bonds that are formed. _____
16. Bonds formed through the sharing of electrons
to form "full" orbits. ______
17. The strongest bonds of the three. ______
Suffixes and prefixes help explain the meaning of
scientific terms. Below are several such scientific suffixes and prefixes
(18-21). Match them with
the appropriate meanings. An answer can be used once, multiple times or not at all.:
- A. Poly-
B. Mono-
C. -saccharide
D. -ose
18. Sugar molecule suffix: ______
19. Many: ______
20. Single: ______
21. Another term for starch (two parts): _____
Click here for the answers to these
questions.
CHAPTER 6 QUESTIONS
There may be more than one right answer to these
questions, however in the actual exam ONLY ONE answer
is allowed.
1. CRITICAL THINKING QUESTION: The second law of
THERMODYNAMICS is important to the acceptance of the evolutionary theory because:
- A. It proves that evolution is true.
B. It is often used by the CREATIONISTS as an argument against evolution.
C. Its discovery lead to the theory of evolution.
D. The theory of evolution was based on this law which has recently been found to be
wrong.
E. It has nothing to do with the evolutionary theory.
2. CRITICAL THINKING QUESTION: The second law of
THERMODYNAMICS is important to the acceptance of the evolutionary theory because:
- A. It proves that evolution happened.
B. Its discovery lead to the theory of evolution.
C. The theory of evolution was based on this law which has recently been found to be
wrong.
D. It is necessary to understand the basics of this law in order to answer the opponents
of evolution.
E. It proves that man had to be created by the intervention of GOD.
3. Choose the following description that best
describes the second law of THERMODYNAMICS:
- A. The total energy of the universe remains
constant.
B. The total energy of the universe decreases as the universe runs down (decays).
C. The NET entropy (disorder or randomness) of the universe decreases as the universe
ages.
D. The NET entropy (disorder or randomness) of the universe increases as the universe
ages.
E. None of the above are correct.
4. Which of the following statements about the
PSEUDOSCIENCES (e.g. astrology) is NOT true.
- A. It is easy to make up the "rules" of
a pseudoscience.
B. Pseudoscience "facts" can not be rigorously tested.
C. Pseudoscience challenges only the imagination, not the intellect.
D. The "facts" of pseudoscience allow predictions to be made (like Gene Dickson
did).
E. Pseudoscience appeals to the desire for "magic" in many people.
5. If any one of the of statements A to C is NOT
true about the SCIENTIFIC METHOD, choose it as the answer, otherwise chose between D
and E:
- A. The SCIENTIFIC METHOD involves developing a
reasonable theory to explain an observation and sticking strongly to it until data is
found to support the theory.
B. The SCIENTIFIC METHOD involves the formulation of hypotheses.
C. The SCIENTIFIC METHOD involves extensive experimentation.
D. None of the above are true.
E. All of the above are true.
6. If any one of the statements A to C is NOT
true about the SCIENTIFIC METHOD, choose it as the answer, otherwise chose between D
and E:
- A. The SCIENTIFIC METHOD involves the formulation
of hypotheses
B. The SCIENTIFIC METHOD involves democratically elected officials studying the various
opposing theories explaining some phenomenon and voting on which one is correct.
C. The SCIENTIFIC METHOD involves extensive experimentation.
D. All of the above are true.
E. None of the above are true.
7. CRITICAL THINKING QUESTION: The
SCIENTIFIC METHOD requires that CONTROLS always be run.
The following study was done to see if there is a
relationship between the increase of lung cancer in women over the past 30 years and
certain behavior.
Identify the proper control(s) below: If only ONE of A, B, or C is correct, choose it as
the answer, otherwise chose D or E as the answer.
- A. Determine the frequency of lung cancer of women
(per 100,000) who have smoked for 10 or more years.
B. Determine the frequency of lung cancer of women (per 100,000) who have not smoked for
the last 10 years.
C. Determine the frequency of lung cancer of women (per 100,000) who have lived with
someone who has smoked for the last 10 years.
D. All of the above are reasonable controls of each other.
E. None of the above are the reasonable controls.
8. A belief in evolution means that you cannot
believe in God. True (A) or False (B)
9. The SCIENTIFIC METHOD requires that all
experimental data be made to fit the hypothesis most favored by the top scientists in a
given field. TRUE (A) or FALSE (B)
10. The SCIENTIFIC METHOD requires that all
experimental data be made to fit the hypothesis most favored by the Pope or other
religious authority. TRUE (A) or FALSE (B)
11. The SCIENTIFIC METHOD requires that all
experimental data be considered SUBJECTIVELY. TRUE (A) or FALSE (B)
12. Evolution is:
- A. A way of describing how biological systems
(organisms) change and adapt so as to survive in a changing environment.
B. An answer to why we are here
C. A plot put forward by the secular humanists to weaken the fabric of our country.
D. A plausible theory without any firm facts to back it up.
E. None of the above are correct.
13. Extreme Creationists are individuals who
believe that:
- A. God set the wheels of evolution in motion and
has left things alone since.
B. The earth is flat.
C. The evolutionary theory is basically correct, except that life (as it exists today)
evolved rapidly in 7 days.
D. The laws of the universe are flexible and are constantly changing.
E. The biblical version of creation is correct in every way.
14. THOUGHT QUESTION: Which of the following
statements is correct (in the context of how evolution was presented to you in lecture):
- A. Evolution is driven by the ability to gather
and efficiently use the energy available in a particular environment
B. The evolutionary theory is a way of explaining the creation of the universe.
C. The evolutionary theory is a way of explaining the purpose of the universe.
D. The evolutionary theory explains how life avoids the second law of thermodynamics
E. None of the above are correct.
15. Which of the following statements best fits
the meaning of the term "natural selection":
- A. Natural selection is random and has nothing to
due with climate, competitors, or enemies
B. Nature has the "ideal" form of life in mind and is constantly selecting out
forms that will eventually produce that "ideal" creature
C. Since the environment of the earth is stable, nature selects survivors based on ability
to cope with this stable environment
D. In the struggle of life the survivors have the appropriate combination of
characteristics for coping with the natural environment they find themselves in
E. All of the above describe "natural selection".
Click here for the answers to these
questions.
CHAPTER 7 QUESTIONS
Use the following choices to answer questions _1_
through _4_. Choices may be used once, more than once, or not at all.
- A. Anabolic.
B. Proteins.
C. Primary.
D. Catabolic.
E. Amino acids.
1 & 2Enzymes are a class of molecules called
__1__ that are composed of __2___.
3 & 4. ___3 __ metabolic processes generally
use or require energy, while __4 ___ metabolic processes generally release or produce
energy.
5. Enzymes work by lowering the energy of
activation: TRUE(A) or FALSE(B)
6. Enzymes work very slowly: True(A) or False(B)
Use the following choices to answer questions _7_
through _10_. Choices may be used once, more than once, or not at all.
- A. Bind
B. Substrate
C. Cofactor(s).
D. Vitamins
E. Active site.
Small molecules that are required by some enzymes
in order to function are called __7 __. When these molecules are organic in nature they
are called __8 __.
The molecule upon which an enzyme acts is called
its' __9__. For an enzyme to carry out its' reaction on this molecule, the molecule
must ___10__to the enzyme.
11. Chose the statement that best explains
"the UNITY OF LIFE":
- A. All living organisms do many of the same
things, using the same or very similar biochemical processes.
B. All life is united because it exists on the earth.
C. All life is united because it requires oxygen to produce energy.
D. All living organisms have all the same enzymes.
E. There is no such thing as "the UNITY OF LIFE" because living creators are so
very different.
12. The main source of energy on earth is:
- A. From ethanol oxidation
B. From metabolism of fats
C. From oxidative of glucose
D. From the sun via photosynthesis
E. From anaerobic metabolism deep in the ocean.
13. Which of the following is NOT a reason for
using microorganisms to study METABOLISM.
- A. Microorganisms are rather boring and don't do
many interesting things except cause diseases.
B. Microorganisms are generally inexpensive to grow and work with.
C. Microorganisms are often used to produce commercial products.
D. Microorganisms have a metabolism that is always similar to that of higher plants and
animals.
E. Microorganisms do many things that higher plants and animals are unable to do.
14. A catalyst is:
- A. Another name for a cofactor.
B. A type of DNA that carries the genetic code.
C. Chemically modified by the chemical reaction it controls.
D. Something that increases the speed of a chemical reaction. E. Something that decreases
the speed of a chemical reaction.
15. The ACTIVE SITE of an enzyme is:
- A. The site where the substrate attaches and is
acted upon.
B. The site where the cofactor binds and is acted upon.
C. The site were the regulatory molecule binds and is acted upon.
D. The site where ATP binds and releases its energy.
E. The site where the coenzyme binds and is modified.
Click here for the answers to these
questions.
Click Here
for a 50 question computer-generated &
graded exam on Chapters 1-7. When the site opens up type your
name in the "User ID: box"; In the "test ID" box type:
Practice Test 1
CHAPTER 8 QUESTIONS
1. Which of the following is the BEST
definition of an ALLELE:
- A. An inheritable alternative of a given gene.
B. An inheritable alternative of a gene that is located on a different chromosome.
C. A partial diploid situation in a haploid organism.
D. A situation where there are only two variations in a given gene.
E. None of the above describe an ALLELE.
Use the following choices to answer questions
_2_through _9_ Choices may be used once, more than once, or not at all.
- A. Thymine.
B. Cytosine.
C. Adenine
D. Uracil.
E. Guanine.
F. Xanthine.
G. Deoxyribose.
H. Tripicate.
I. 1000.
J. 340.
The average gene consists of approximately
__2__base pairs.
The four bases of DNA are (put the bases
in alphabetical order ): __3___, ___4__, __5___, __6___.
In RNA the base __7___is replaced by the
base __8___.
The genetic code is a/an ___9___code.
10. Which of the following statements about DNA
is WRONG.
- A. A DNA molecule is usually arranged in a double
strand.
B. The backbone of DNA consists of alternating sugar (deoxyribose)-sulfate groups, with
the bases attached to the sugar molecules.
C. The complementary strands of DNA are held together with weak hydrogen bonds.
D. The DNA molecule usually takes the form of a triple helix.
E. DNA never contains the base uracil.
11. Genes come in several functional types (what
they do or what they code for): Which of the following coding-types described below is
WRONG?
- A. There are genes that code for proteins that are
enzymes.
B. There are genes that code for membrane lipids.
C. There are genes that code for ribosomal RNA.
D. There are genes that code for proteins that are regulatory proteins.
E. There are genes that code for coenzymes.
F. There are genes that code for LPS.
Use the following choices to answer questions
_12__ through _19_. Choices may be used once, more than once, or not at all.
- A. Stop codon.
B. Promoter.
C. RNA polymerase.
D. Translation.
E. Transpolymerization.
F. Transcription.
G. Transformation
H. mRNA.
I. Ribosomes.
J. tRNA.
The first stage in the process of transferring
the information in DNA into a product is _12_. In this process the DNA is copied in
the form of _13_ by the enzyme _14_, which binds at the DNA site called the
_15_. The _16_ so produced is converted to protein by the process called _17_.
This process occurs on structures called _18_. The amino acids are carried to the
sites of protein synthesis by _19_ molecules.
The following is a DNA sequence of the
"sense" or template strand of a gene: AGGCTACGA.
Based on the above sequence, identify the
following nucleic acid sequences that are derived from this sequence.
- A. AGGCTACGA
B. AGGCUACGA
C. UCCGAUGCU
D. TCCGATGCT
20. The m-RNA made from the DNA.
21. The anticodons (reading from left to right)
for the three amino acids that this DNA codes for.
Click here for the answers to these
questions.
CHAPTER 8 ESSAY QUESTIONS
QUESTIONS
- Draw a reasonable replica of the figure on pg. 3
showing the role of ligand/receptor interaction in life-processes and write an explanation
of its significance listing as many examples as you can think of.
- Describe G. Mendel's discoveries and explain their
significance to the science of genetics.
- Describe how transformation was discovered. Draw a
picture illustrating the salient points and explain the significance of this discovery to
the science of genetics.
- Do the same (as #3) with the discoveries of Watson
and Crick and G. Beadle.
- List the chemical composition of both DNA and RNA,
pointing out their similarities and differences.
- Discuss the significance of the A-T and G-C base
pairing and draw a general DNA molecule, labeling the 3 general components.
- Describe the replication of DNA during cell
division. Name the enzyme that is responsible for this process and draw a picture showing
how it works.
- Discuss the nature of the genetic code,
explain/defining all the vocabulary that goes with it.
- Describe what M. Nirenberg did and its
significance to our understanding of molecular genetics.
- Explain, on molecular terms, what a mutation is
and how they are induced. Draw 5 examples of the major types of mutations.
- Explain what alleles are and why they are
important in evolution; why does Mother Nature like them.
- Explain the important of sex in genetics and
evolution. Include a discussion of dominance and recessive and of diploid and haploid and
give examples. Also explain what happens when a germ cell develops and how this affects
life.
- Describe the processes of transcription and
translation in detail. Draw a figure illustrating the events that occur during each. Label
each component and write a sentence explaining its role in the process. Include all the
appropriate terminology in your discussion.
- Describe the lac operon as an example of how the
synthesis of enzymes is regulated in living organisms. Draw a figure illustrating the
events that occur during the process of induction by lactose, label and explain each
step/component. Explain how this can control development during embryonic growth. Use all
the appropriate vocabulary in the discussion.
CHAPTER 9 QUESTIONS
Write the answers to the following questions:
Bacteria have three ways of exchanging DNA. From
the following statements identify each system that a statement refers to in questions 1-5:
1. Involves bacteriophage that pick up pieces of bacterial chromosomal DNA
__________________.
2. Involves the uptake of cell-free or naked DNA by a cell through its cell wall
__________________.
3. Is the major means of transferring antibiotic resistance factors between bacteria
__________________.
4. The method of transferring DNA between bacterial cells that requires cells in a special
physiological state __________________.
5. Requires cell-to-cell contact ____________________.
6. The cell from which the DNA in a transfer originates is called the ______________.
7. The cell into which the DNA is transferred is called the __________________.
8. The most common method of moving genes between bacterial cells in the lab is
_________________.
9. The common vehicles for moving genes about are called __________________.
10. These vehicles (#9) range in size between ______________________.
11. What is the physical structure of (#9)? ______________________.
12. The first mechanism of gene transfer between bacteria was ___________________.
13. The gene transfer(s) between bacteria that always required recombination.
____________________.
14. The long protein appendages that are involved in one form of bacterial genetic
exchange ____________________.
15. To transfer genes from one bacterium to another the donor cell must contain a special
type of DNA called ___________________________.
16. This special type of DNA (#15) carries a group of special genes called
_____________________.
17. Transduction is carried out by:
- A. Naked DNA
B. A bacteriophage
C. Sex pili
D. Forming a Conjugation bridge.
18. The plasmid responsible for conjugation is
called a:
- A. Sex plasmid
B. Resistance plasmid
C. Virulent plasmid
D. Fertility plasmid
Click here for the answers to these
questions.
CHAPTER 9 ESSAY QUESTIONS
QUESTIONS
- Draw a diagram illustrating the three type of
bacterial exchange of DNA. Label each component and describe what each does and what
happens at each step of the process.
- Describe the types of experiments you would do to
differentiate between the three types of genetic exchanges described in this chapter.
- Define Plasmids and draw a picture of one. Explain
their survival value to the bacteria.
- Explain how the original antibiotic resistance
gene forms and then how it spread among so many bacteria.
CHAPTER 10 QUESTIONS
- The process of manufacturing and manipulating
genes under controlled conditions is called __________________.
2. This science is made possible by special enzymes called __________________.
3. These special enzymes do what to DNA? _______________________.
4. Where, in general, do these special enzymes do what they do to DNA?
____________________.
5. Draw one such site (#9). ___________________________.
List the 4 basic steps (in order) in cloning foreign DNA.
- 6. Step one.
___________________________________________..
7. Step two ____________________________________________.
8. Step three ___________________________________________.
9. Step Four ___________________________________________.
10. Ligase is more efficient at fusing:
- A. Blunt ends
B. Sticky ends
C. Both ends the same.
11. Find the likely restriction enzyme in this
sequence: AATCCTAGGACG
12. The science of DNA fingerprinting relates to
Fig. 2 chap7:
- A. Because Fig. 2, chap 7 illustrates the binding
of ligase to the DNA cut by restriction enzyme.
B. Because Fig. 2, chap 7 illustrates the principle of ligand/receptor binding.
C. Because Fig. 2, chap 7 illustrates the principle of enzyme/substrate interaction.
D. Because Fig. 2, chap 7 illustrates the process of DNA cleavage by restriction enzymes.
E. Because Fig. 2, chap 7 illustrates the genetic code.
13. Which of the following is NOT true about
agarose gel electrophoresis of DNA fragments.
- A. The larger DNA fragments are always closest to
the wells.
B. The larger DNA fragments are always furthest from the wells
C. The agarose is chemically related to the agar used in petri dishes.
D. The DNA is negatively charged.
14. A DNA-probe sticks to its target DNA because:
- A. Of hydrogen bonding to bases on the
membrane-bound DNA.
B. Of covalent bonding
C. Of Ligation to the membrane-bound target DNA.
D. Of DNA polymerase directed synthesis of complementary DNA strands.
E. Of complementation to bases on the single stranded DNA bound to the membrane.
15. When restriction-digested genomic DNA is run
on an agarose gel:
- A. Thousands of individual bands are clearly
visible.
B. A few distinct, well separated bands are seen when the gel is stained.
C. Genomic DNA is too complex to be digested by restriction enzymes.
D. A smear of material is seen when the gel it stained.
E. Only the smaller bands are visible as separate bands.
Click here for the answers to these
questions.
PCR was used on the "BLUE DRESS" to proves President Clinton's association with
Monica. What was done at each of the steps A-F to prove this. Answer
This is a DNA fragment containing a palindromic site. Between which bases (A-D) would a
6-base restriction enzyme cut the DNA strands in order to produce a 4-base sticky end?
Where would a restriction enzyme cut to produce a blunt end? Answer
|
|
CHAPTER 10 ESSAY QUESTIONS
QUESTIONS
- Explain the what restriction enzymes are, what
they do and why they were key to starting the genetic engineering revolution. Show how
restriction enzymes produce sticky and blunt end cuts. Draw a typical restriction enzyme
site and explain what a palindromic site is.
- Find the restriction enzyme sites in these DNA sequences: CCTAGT;
AATCCTAGGACG; AAATTAATCGG; TAAGGCGCGCCTAAT;
TACGCCAAGCTTGCATGCCTGCAGGTCGACTCTAGAGTATCCCCGGGTACCGAGCTCGAATTCACT.
- Explain the role of the ligase enzyme in gene cloning.
- List the basic steps involved in GENETIC ENGINEERING and describe what
each component does. Draw a picture showing the various steps in cloning the Insulin gene.
- Name 5 things you can do with cloned DNA and explain the importance of
each.
- Discuss DNA FINGERPRINTING. Describe a typical DNA fingerprinting test
from start to finish (including the details of how hybridization and probing works). Draw
each step and detail what is happening. Illustrate what occurs in an agarose gel when it
is used to separate the fragments of DNA. Include an explaination of RFLP.
- Explain the PCR. List the steps in carrying it out; include all the
components and special conditions, explaining why each one is used. Illustrate the process
with appropriate labels. Use the correct scientific terminology in your explaination.
CHAPTER 11 QUESTIONS
In lab exercise #17 you diluted and plated some
bacteriophage. From the following data answer the questions & calculate the titer
(concentration) of the original phage stock culture per ml:
- A. Remove 0.1 ml of the original phage stock and
mix it with 0.9 ml of dilution buffer. This is a ____1____ dilution of the original phage
stock.
- B. From the dilution tube above you remove 10
microliters (0.01 ml) and mix it with 1.0 ml of dilution buffer. You now have a
______2_____ dilution of the original phage stock.
- C. Repeat step (B) which will give you a
______3_____ dilution of the original phage stock.
- D. You then remove 5 microliters of the last
dilution tube (C ) and mix it with the host bacteria in soft agar and pour the entire
contents onto medium in a petri dish. After incubating the culture overnight you count 293
plaques on this plate. The titer of the original phage stock is: 4 _______?/ml____.
Use the following choices to answer questions __5__through
__9__. Choices may be used once, more than once, or not at all.
- A. Capsomeres
B. Bacteriophage
C. Naked
D. Capsid
E. Enveloped
The surrounding protein coat of a virus is called
the __5_ and is composed of protein subunits called _6_.
Viruses that are only covered with a protein coat
are called __7__ viruses, while those that have an additional membrane covering are
called __8_ viruses. Viruses that live off of bacteria are called __9_.
10. The discoverer of viruses was: _______________.
Describe viruses: #11 - 14
11. According to their growth conditions:
12. Nucleic acid content:
13. Enzyme content:
14. Size range:
The 5 steps in the life cycle of a virus are (in
the order of their occurrence):
15. _______________
16. _______________
17. _______________
18. _______________
19. _______________
20. The etiological agent of Mad Cow Disease is
a: ___________.
21. The chemical nature of the etiological agent
of Mad Cow Disease is a: ___________.
Identify the various phage components. For the answer click here.
|
CHAPTER 11 ESSAY QUESTIONS
QUESTIONS
- Describe how viruses and bacteriophage were
discovered.
- Draw the T-even bacteriophage and label all the
structures. Tell what each one is used for.
- Describe what a virus is and tell how it is
different from a bacterium or any other life form. Include a description of the general
structure of all viruses, including their genetic material. Draw a generalized naked and
enveloped virus.
- Describe the 5 steps of a typical virus life cycle
and tell what is occurring in each one.
- Describe the two major ways that Eukaryotic
viruses enter their host cells and draw a picture showing the steps involved.
- Describe the major ways that Eukaryotic viruses
exit cells.
- Explain what prions and viroids are and what
diseases they cause. Briefly discuss why one of these have been in the press lately.
Click here for the answers to these
questions.
Click Here
for a 50 question computer-generated &
graded exam on Chapters 1-7. When the site opens up type your
name in the "User ID: box"; In the "test ID" box type:
101 Practice Test 2
CHAPTER 12 QUESTIONS
1. AIDS can best be classed as a/an:
- A. Pandemic
B. Epidemic
C. Endemic
D. Opportunistic infection
E. Nosocomial infection
2. The normal flora of a human is NOT known to do
which of the following? If ONE of A to C is the answer choose it, otherwise chose D or E.
- A. Produce diseases under certain conditions.
B. Protects us against many pathogens.
C. Produces anti-carcinogenic chemicals.
D. All of the above (A, B, & C).
E. Only B & C.
3. One of our nonspecific defense mechanisms is
the ACID in the stomach. Yet we get intestinal illnesses. Why?
- A. Most of the intestinal pathogens are naturally
resistant to acid conditions.
B. Because pathogens are protected in large pieces of food.
C. Intestinal pathogens enter first through breaks in the skin and are subsequently
carried by the blood to the intestine.
D. The natural flora in the bowel mutates to produce pathogenic varieties that attack the
intestines.
E. Pathogenic spores passed safely through the acid in the stomach.
4. A NOSOCOMIAL infection is:
- A. An infection that one catches from an animal.
B. An infection that one gets from drinking contaminated water.
C. An infection that one gets from an insect bite; i.e., Lyme disease from the tick.
D. An infection that a hospital patient picks up at the hospital from the personnel or
materials used in the hospital.
E. Antibiotic resistant bacteria found in a hospital setting due to the heavy use of
antibiotics.
5. The letters "CDC" refer to:
- A. Circulatory Defense Cells
B. Centers for Disease Control
C. Condition of Disease Control
D. Center for Diagnosis of Cancer
E. Cancer Destroying Cells
6. VIRULENCE refers to:
- A. The number of people in a population who are
infected by a certain pathogen.
B. The degree or intensity of pathogenicity.
C. A pathogen that has lost its ability to produce a disease.
D. Pathogens that only infect people with a repressed immune system
E. Pathogens that are spread through the soil.
Skin has 7 characteristics that make it a good
nonspecific defense mechanism. Name them and tell how each works.
7. _______
8. _______
9. _______
10. _______
11. _______
12. _______
13. _______
14. Which of the following NSD system protects
the genitourinary tract from infection?
- A. Adhesive pili that bind the invading microbes.
B. Flushing of mucus
C. Production of acid in the vagina
D. Production of antibiotics by cells lining the urethra.
E. Flushing of urine
15. Describe how the construction of the nasal
passages helps prevent infection.
Click here
for the answers to these
questions.
CHAPTER 12 ESSAY QUESTIONS
- Define the following terms and describe one
example for each well enough to clearly differentiate the term from any others in the
list:
- Disease; give the various catogories of diseases.
- Etiological agent
- Normal flora
- Parasite
- Pathogen
- Infection
- Infestation
- Define symbiosis
- Explain Mutualistic symbiosis.
- Define virulence and pathogenicity and illustrate
with two examples (what is the "pucker factor"?).
- Explain how avirulent forms are made or occur.
- Describe what an "opportunisitic
pathogen" is and describe several situations where they might cause an infection.
- When you purchase a new car it comes with
"standard features". How is this similar to the bodies' nonspecific defense
system?
- Describe how each of the following nonspecific
defense systems work to protect you and give two examples of ways that they are often
wrecked by behavior or life style (things you or your friends or family do).
- Skin
- Mouth and gastrointestinal tract
- Genitourinary tract
- Respiratory tract
- What is lysozyme and where is it found?
CHAPTER 13 QUESTIONS
- All organisms that infect us produce a disease.
True (A) or False (B).
- One of our nonspecific defense mechanisms is the
ACID in the stomach. Yet we get intestinal illnesses. Why?
- A. Most of the intestinal pathogens are naturally
resistant to acid conditions.
B. Because pathogens are protected in large pieces of food
C. Intestinal pathogens enter first through breaks in the skin and are subsequently
carried by the blood to the intestine.
D. The natural flora in the bowel mutates to produce pathogenic varieties that attack the
intestines.
E. Pathogenic spores past safely through the acid in the stomach.
Match the following terms with the next 5
statements or descriptions below. A term may be used more than once or not at all.
- A. Disease
B. Pathogen
C. Parasite
D. Symbiosis
E. Virulence
3. An organism that lives ON or IN a host and
obtains nutrients from that host is a: ____ _____
4. Any change from a state of good health. _____
____
5. Refers to the degree of pathogenicity. _____
____
6. An organism that lives on or in a host and
causes harm to that host is a: _____ ____
7. The condition of two or more organisms
normally living and interacting together is called a: ____ _____
Match the following NON SPECIFIC DEFENSE
mechanisms listed below (A-D) with the next 5 statements describing how the NSD WORKS. A
choice may be used once, more than once or not at all.
- A. Mucous
B. Urination
C. Cilia movement in nose and lungs
D. Skin
E. Normal flora
8. Composed mostly of dead cells. ____ _____
9. Traps microbes and keeps them away from
potential host cells. _____ ____
10. Out competes potential pathogens. _____ ____
11. Contains salt, fatty acids and urea, all of
which inhibit many microbes. _____ ____
12. Moves trapped microbes into mouth where it is
swallowed. _____ ____
13. Which of the following is NOT a step or STAGE
in the disease process.
- A. Incubation period
B. Establishment in host
C. Infection
D. Production of a septicemia
E. Development of clinical symptoms
14. Another name for ENDOTOXIN is:
- A. Diphtheria toxin
B. LPS or lipopolysaccharide
C. Tetanus toxin
D. Cholera toxin
E. Capsule
15. The name of the enzyme that destroys red
blood cells is:
- A. Leucocidin
B. Endolysin
C. DNase
D. Hemolysin
E. Lipase
Click here
for the answers to these
questions.
CHAPTER 13 ESSAY QUESTIONS
- Explain what the terms "symptoms" and
"clinical symptoms" mean and how they are different. Give some specific examples
of each. Give examples of diseases that are difficult to diagnose from their symptoms.
- You have learned previously how modern molecular
biological technology will (is) help (helping) in the diagnosis of diseases and giving use
information quickly that has previously taken days to obtain. Describe two of these
procedures.
- Define the term "septicemia" and explain
the difference between a "bacteremia" and "viremia". Which one of the
latter might you be able to treat with an antibiotic?
- Define the term "virulence determinant or
factor" (VD) and describe/define the following VD in terms of how they work.
- Exotoxins; give two examples.
- Endotoxins
- Enzymes; give three specific examples.
- Attachment systems.
- Describe the five steps in the disease process.
- Explain what "subclinical" illnesses are
and why they are so common.
- Discuss the situation of "carriers" of
diseases and explain the different types.
CHAPTER 14 QUESTIONS
1. AIDS can best be classed as a:
- A. Pandemic
B. Epidemic
C. Endemic
D. Opportunistic
E. Nosocomial infection
2. A NOSOCOMIAL infection is:
- A. An infection that one catches from an animal.
B. An infection that one gets from drinking contaminated water.
C. An infection that one gets from an insect bite; i.e., Lyme disease from the tick.
D. An infection that a hospital patient picks up at the hospital from the personnel or
materials used in the hospital.
E. Antibiotic resistant bacteria found in a hospital setting due to the heavy use of
antibiotics.
3. An epidemiologist would NOT do which of the
following
- A. Infect other humans with the suspected pathogen
without their permission.
B. Test feces, urine and spit of a victim for the etiological agent.
C. Collect statistics on the number and location of the victims of a disease.
D. Collect insects from the area where the disease exists.
E. Inject, drink or otherwise expose himself purposefully to material containing the
suspected agent.
4. Which of the following is NOT a good way to
BREAK the cycle of infection in an epidemic? (8/29)
- A. Immunize the entire population against a
disease.
B. Destroy or eliminate the vector (if possible).
C. Educate the population to change behavior that contributes to the spread of a disease.
D. Improve sanitation.
E. Give the entire population shots of broad spectrum antibiotics so as to kill off the
pathogen.
Match the following DISEASE TRANSMISSION
mechanisms listed below (A-E) with the next 5 statements describing how DISEASES are
spread. A choice may be used once, more than once or not at all.
- A. Direct contact
B. Chronic Carriers
C. Fomites
D. Transient carrier
E. Vector
5. A mosquito infecting a person with malaria is
an example of a/an:
6. A shared drinking cup infecting people using
it is an example of a/an:
7. An HIV+ person infecting others is an example
of a/an:
8. A person sitting next to you on the bus who
infects you with TB is an example of a/an:
9. A person sitting nest to you on the bus who
infects you with the flu is an example of a/an:
10. Which of the following choices is NOT a good
way of "breaking the cycle of infection"?
- A. Identifying and treating those with the
infection.
B. Having everyone in an area eat a good diet.
C. Providing hygienic conditions.
D. Immunization of the population if a vaccine is available.
E. Eliminating of the pathogen's reservoir.
Click here
for the answers to these
questions.
CHAPTER 14 ESSAY QUESTIONS
- Describe and explain what the "science of
epidemiology" and how it is carried out. In your discussion tell how the
"first" such study was done and who did it & how did it come out.
- Explain how epidemiological studies apply to such
diseases as AIDS, lung cancer and HERPES infections.
- Define the following terms and give two examples
where appropriate.
- Reservoir of a pathogen
- Zoonoses
- Inanimate reservoir
- List the 6 "portals of entry".
- Describe the 4 major mechanisms of disease
transmission. Give examples of each that you are familiar with.
- Discuss the "carrier" issue and explain
why it is important to public health to use taxpayer money to deal with the problem.
- Explain why everyone who enters a hospital (for a
stay) should be concerned about acquiring an infection. What are such infections called
and why are they so dangerous.
- Explain the difference between endemic, epidemic,
pandemic and mortality and morbidity. Give examples of each.
- If you were to become an epidemiologist how would
you explain your job (in detail, because your mother is a smart person--she has survive
you; right) to your Mother?
- What is the best epidemiological organization in
the world and where is its head office located.
- Explain how each of the 5 ways that are used to
"break cycles of infection" work.
CHAPTER 15 QUESTIONS
1. An EPITOPE is:
- A. A species of antibody that is responsible for
allergies.
B. A group of atoms that induce the formation of a specific antibody.
C. Another name for the variable region of an antibody.
D. An antigen that originates from the cell wall of bacteria.
E. A unique region of DNA that directs the formation of the HIV virus.
2. Antibodies are produced at a very rapid rate
by the cells that make them:
Match the following terms with their descriptions
below:
- A. Innate immunity
B. Active acquired natural immunity
C. Natural passive immunity
D. Active acquired artificial immunity
E. Artificial passive immunity
3. An injection of gamma globulin _______.
4. An active infection of a pathogen that you
survive ______
5. A drink of breast milk by a baby ______
6. Immunity that you are born with _____
7. Drinking the live attenuated polio virus _____
8. The best definition of HUMORAL immunity is:
- A. Immunity involving soluble antibodies.
B. Immunity involving STEM CELLS.
C. Immunity involving the lymphatic system.
D. Immunity involving T-cells.
E. Immunity involving platelets.
9. The best definition of SPECIFIC CELL MEDIATED
immunity is:
- A. Immunity involving MACROPHAGE CELLS.
B. Immunity involving STEM CELLS.
C. Immunity involving the lymphatic system.
D. Immunity involving T-cells.
E. Immunity involving platelets.
10. The most common type of antibody is:
- A. IgG
B. IgE
C. IgM
D. IgA
E. IgD
11. Each antibody has THREE binding sites, one at
the end of each arm of the "Y".
12. Which of the following statements BEST
EXPLAINS how the body makes the many DIFFERENT ANTIBODY TYPES:
- A. During antibody formation the antibody gene
fragments for the LIGHT portions of the VARIABLE regions are randomly shuffled.
B. During antibody formation the antibody gene fragments for the LIGHT and HEAVY portions
of the NONVARIABLE regions are randomly shuffled.
C. During antibody formation the antibody gene fragments for the HEAVY portions of the
VARIABLE regions are randomly shuffled.
D. The human genome contains codes for over a 100 millions different antibodies.
E. During antibody formation the antibody gene fragments for the LIGHT and HEAVY portions
of the VARIABLE regions are randomly shuffled.
13. Which of the following best describes the
antibody manifestation named NEUTRALIZATION?
- A. A toxin is rendered (made) inactive by the
reaction with its specific antibody.
B. A pathogen is neutralized by the reaction with specific antibodies against its cell
wall proteins.
C. A soluble virus forms neutralizing clumps with its specific antibody.
D. T killer cells are neutralized by their interaction with macrophages.
E. Antibody production by PLASMA-CELLS is neutralized by the HIV virus.
14. The best description of a Tc or T-killer cell
is:
- A. An immune cell that attacks and destroys cells
containing VIRAL ANTIGENS.
B. An immune cell that attacks and destroys cells containing the HIV virus.
C. An immune cell that attacks and destroys cells containing a SPECIFIC ANTIGEN.
D. An immune cell that attacks and destroys T-helper cells.
E. An immune cell that attacks and destroys macrophages containing antigens of the
BACTERIA OR VIRUSES they have engulfed and digested.
15. MAST CELLS are involved in:
- A. Destroying cancer cells.
B. Attacking virus infected cells.
C. In making antihistamine.
D. Immune cell differentiation.
E. Allergies
Click here
for the answers to these
questions.
CHAPTER 15 ESSAY QUESTIONS
- Explain/discuss the following statement: The
underlying principle of specific immunity lies in the bodies' ability to distinguish
"self from nonself".
- Discuss/compare the concepts of
"antigen" and "epitope", pointing out their similarities and
differences.
- Describe/define an antibody in both general and
specific terms. Draw a typical antibody molecule and label the various parts and tell what
the important ones are.
- What exactly are "lymphocytes"? How do
they differ from the WBC on the nonspecific defense system.
- Discuss "innate vs acquired immunities".
Give examples of both types.
- What exactly are vaccines? How are they
made/obtained? What is the likely future of vaccines.
- What is mean by the statement that the
"specific immune system is a dual system"? (If this doesn't take you about 3 pgs
of writing to explain you don't know the answer).
- Describe the stages in the development of the
specific immune system, being sure to describe where in the body important events occur.
Draw a picture of the process and label each component.
- As part of #8 or separately describe how the
clonal selection process works. Draw a picture show each step and component and label
each. Explain what "memory cell" do and how the "remembering response"
works.
- Explain how the body makes the millions of
different kinds of antibodies it does. Draw a picture illustrating this process.
- Describe "T-cell" immunity and explain
the crucial role Th-cells play in the entire immune process.
- Define autoimmune disease and give some examples.
- Describe how allergies occur and explain what
special cells and antibodies function in the process. Include a description of how
"anaphylaxis" can kill you in a few minutes.
- If a women that is Rh negative is carrying an Rh+
baby what can happen if it is her first Rh+ baby? If it is her 2nd Rh+ baby? Draw a
picture showing the two events.
- Explain this statement from a recently published
article on flu vaccination both in immunological epidemiological terms: The use of live attenuated viruses in influenza vaccines offers several
potential advantages over parenteral inactivated vaccines, including induction of a
mucosal immune response that closely mimics that induced by natural influenza virus
infection. In addition, the superiority of such vaccines in protecting the upper
respiratory tract could potentially be a useful strategy to limit the spread of influenza
virus during epidemics.[
-
CHAPTER 16 QUESTIONS
1. The major reservoir of GONORRHEA is:
- A. Asymptomatic males. ANSWER: A small % of males do
not show symptoms and are also part of the reservoir of GC.
B. Equally asymtomatic males and females.
C. People who have AIDS.
D. Asymptomatic females.
E. Homosexual prostitutes.
2. Which of the statements about Herpes simplex
infections is NOT correct:
- A. Type 2 virus only produces genital herpes.
B. Type 1 Herpes simplex can infect both below and above the waist.
C. Genital herpes can be partly controlled by the drug Acylovir.
D. Neonatal herpes infection is a frequent cause of death or mental retardation of
newborns.
E. The epidemic of genital herpes is a major cause of Cesarean births.
3. Which of the following STDs commonly cause
sterility?
- A. AIDS & gonorrhea
B. Gonorrhea & nongonococcal urethritis
C. AIDS & syphilis
D. Syphilis and nongonococcal urethritis
E. None of the above
4. The initial symptom(s) of syphilis is/are:
- A. Painful blisters in the genital or anal areas
that open up and "weep" and that heal up in about 2 weeks.
B. A hard, painless open sore usually on the genital region (penis or cervex) that
spontaneously heals in a few days.
C. No clear symptoms.
D. Pain & pus in the urethra, difficulty urinating.
E. Watery discharge, difficulty urinating.
5. AIDS is currently the most commonly reported STD
in the US. True (A) or False (B)
6. The major mode of transmission of STDs is by:
- A. Homosexual intercourse.
B. From blood transfusions.
C. By donating blood.
D. Heterosexual intercourse.
E. Rape.
7. Because of their DISTINCTIVE APPEARANCE a person
infected with the HIV virus is easy to spot.
8. Because it is "hard to transmit" you
CAN'T get an HIV infection on the first exposure.
9. If you sit beside someone on the bus, plane or
train with full blown AIDS, you are more likely to get tuberculosis than an HIV infection
from them.
10. HIV can be caught in a number of ways listed
below:
- 1. By a fetus/baby from an HIV positive mother
during pregnancy.
2. By a doctor or nurse cutting themselves while operating on an HIV positive patient.
3. By the sharing of unsterile needles while injecting drugs.
4. By taking receiving an infected blood transfusion.
5. By having unsafe sex with HIV positive partners.
Which of these ways represent the THREE most COMMON
ways of becoming infected with HIV.
- A. 1, 3, 4
B. 2, 3, 5
C. 1, 3, 5
D. 1, 2, 3
E. 1, 4, 5
11. The spread of HIV could (at the present time)
be most easily controlled by:
- A. The use of current VACCINES against HIV.
B. The use of ANTIVIRAL DRUGS to eliminate HIV.
C. The use of CONDOMS
D. A change in human behavior involving limiting unsafe sexual practices.
E. Eating a healthy diet and getting lots of exercise.
12. If you have genital herpes, you can NOT pass it
on to another person if you do NOT have any visible herpes lesions.
13. Genital herpes is one of the major reasons for
Cesarean births these days.
14. Death from AIDS is caused (the actual agent[s])
by:
- A. Massive growth of the HIV
B. Opportunistic infections
C. Herpes infections
D. Tapeworms
E. Heart failure
15. CRITICAL THINKING QUESTION: Which of the
following is NOT a problem caused by AIDS? If one of A-C is the answer chose it, otherwise
chose D or E.
- A. Increased tuberculosis
B. The disproportionate death of talented young people
C. Homophobia
D. A & B
E. A & C
Click here
for the answers to these
questions.
CHAPTER 16 ESSAY QUESTIONS
- Explain how religious and social attitudes affect
the spread of STDs (STIs).
- Describe the major symptoms, sequela and
transmission of the following STDs: Gonorrhea; Nongonorcoccal urethritis; Syphilis;
Genital Herpes.
- Describe the majors ways HIV is transmitted between
human hosts today.
- Discuss the statement: "We have it within our
power to eliminate HIV from the planet earth".
- What are the 8 HIV/AIDS myths discussed in class.
Discuss why they are "myths".
- Why can we not use Koch's Postulates to prove that
HIV is the etiological agent of AIDS?
- Draw the "Course of AIDS" figure discussed
in the text, including all the factors shown. Describe what each of them means regarding
the course and outcome of an HIV infection. Try this on a non-science friend and see if
they can understand what you are saying. If they can't you probably don't understand it
yourself.
- What is the typical, or usual, actual cause of death
in people with AIDS? Explain.
- What are the drugs that are currently used to treat
AIDS & how do they work?
- Discuss some AIDS-related affects that AIDS has on
society.
- Discuss how (in theory) one can avoid catching HIV
and other STIs and why they often don't work in actual practice. Describe any that apply
to you personally.
Click here
for a full exam #3 on Chapters 13-17. When the site opens up type your name in the
"User ID: box"; In the "test ID" box type: Self Test 3a
CHAPTER 17 QUESTIONS
1. The man who developed the modern flush toilet:
A. Edward Hemorrhoid
B. James Flushmuch
C. George L. John
D. Rupert P. Pile
E. Thomas Crapper
2. Many people (several million) in the U.S. drink what is essentially RECYCLED sewage
water. True (A) or False (B)
3. Chose the best definition of an AQUIFER:
A. A type of water-loving bacteria that is in activated sludge.
B. A type of water treatment facility.
C. A type of spring that flows all the time (without requiring a pump).
D. An underground water bearing layer of soil, sand or rock.
E. A type of parasitic water-borne pathogen.
4. Which of the following sewage treatment facilities is better suited for use in large
cities where land is expensive?
A. A trickling filter plant.
B. A sewage lagoon.
C. Septic tanks.
D. Sludge digestion.
E. An activated sludge plant.
5. The primary and preliminary stages of sewage treatment are designed to:
A. Lower the BOD by 85 to 95%.
B. Mix chlorine in with the sewage.
C. Add large quantities of oxygen to the sewage.
D. Collect the settlable matter.
E. Collect the floc.
6. The typical secondary sewage treatment plant does NOT:
A. Produce a lot of MICROORGANISMS .
B. Kill 99.99% of the pathogens present in the raw sewage.
C. Produce a lot of methane.
D. Produce potable water.
E. Produce a good medium for the growth of algae.
7. Activated sludge from the secondary settling tank is used in sewage treatment for
the following reason: S94F93
A. Lower the BOD by 85 to 95% by aerobic digestion of the easily biodegradable material
in the sewage.
B. Mixing chlorine in with the effulent before releasing it to the environment.
C. Add large quantities of nutrient to the sewage.
D. It provides a source of hungry microorganisms adapted to using the organic material in
the sewage.
E. Collect the floc from the aerobic digestion.
8. A major problem with landfills & toxic waste dumps is that they often leak and
pollute the surrounding land and water. True (A) or False (B)___.
9. Which of the following sewage treatment facilities is better suited (in terms of
cost to the tax payer) for use in small cities where land is flat and inexpensive?
A. A trickling filter plant.
B. A sewage lagoon..
C. Septic tanks.
D. Sludge digestion.
E. An activated sludge plant.
Use the following choices to answer questions __10___ through __13__.
Choices may be used once, more than once, or not at all.
A. Activated sludge.
B. Trickling filter.
C. Preliminary.
D. Secondary.
E. None of the above.
10. The type of sewage treatment plant where the aerated sewage is run
over large inert objects like rocks.
11. The type of sewage treatment plant where the sewage is aerated
vigorously in large tanks 10 to 20 ft deep.
12. The type of sewage treatment that can remove radioactive materials.
13. The Name of the most common type of sewage treatment plant used to
treat sewage in the U.S. today.
14. Potable water is:
A. Rich in fecal coliforms.
B. The product of a secondary sewage treatment plant.
C. Water rich in viruses.
D. Water that is fit to drink (safely).
15. It is estimated by the World Health Organization that approximately ____
people, mainly CHILDREN, per day die, world-wide, from WATERBORNE DISEASES:
A. 100,000;
B. 40,000;
C. 80,000;
D. All of the above are too low.;
E. All of the above are too high;
16. If the world’s water was equated to a gallon of water how much of that would
be FRESH WATER?
A. A teaspoon
B. One ml
C. About 25% or 1/4
D. A little over a tablespoon
E. One tiny drop.
17. One of the problems of dealing with water pollution is illustrated by:
A. The story of Moses and the Nile turning to "blood"
B. The fact that wetlands, which makes less fresh water available for human use, are
increasing.
C. The story of the "Goose that Laid the Golden Egg".
D. The analogy of the frog-in-the-frying-pan.
E. The history of sewers.
Name each of the parts (A-K) of this typical secondary
sewage treatment plant. Tell what happens in each one and how this helps clean up sewage.
Draw arrows showing the flow of the sewage effluents at every stage. For the answer go to
the figure in Chapter 17.
Click here for the answers to these
questions.
CHAPTER 17 ESSAY QUESTIONS
- Discuss the role of water in the evolution and
functioning of life on earth.
- Discuss why all settlements developed near water.
- Define/explain the difference between potable,
polluted and fresh water.
- What is sewage; give examples of several different
kinds.
- Describe the water formulas given in the chapter and
explain what each means.
- Discuss briefly the history of lavatories and
sewage systems. How did the Romans bring water to many of their larger cities?
- Explain what the statement "obtaining and
maintaining a potable water supply for the peoples of the earth is a complex
problem".
- Explain the metaphor of "the frog in the frying
pan" and tell how it relates to pollution in general and water pollution in
particular.
- Explain the "Dilemma of the Wetlands".
- In one paragraph write a textual explanation
of the
principle of sewage treatment. Try is on a non-science friend or relative and see if they
understand what you are talking about. Explain the central role of microbes in this
process.
- Describe the two most common types (designs) of
cummunity sewage treatment plants.
- Draw a typical sewage treatment plant. Lable each
component and describe it roll in the plant. Using arrows show the flow of water and other
components through the plant.
- Explain EBOM and explain its meaning in terms of
sewage treatment.
- Explain where methane is produced in a sewage
treatment plant and how it is made.
- Draw a cartoon showing how polluted water is
converted into potable water. Explain & label each step in the process.
- Explain the principles behind the workings of the
different home water purification units. Explain where and why each should be used.
- If you get an infection from drinking "polluted
water" what does that usually mean you have drunk? Explain.
- Explain the major characteristics of the WBD
discussed in this Chap.
- What is oral rehydration therapy and how/why does it
work? Give the recipe for making the reagent used in this treatment & describe the
function of each component.
- Describe the pathology of Helicobacter pylori and
tell how it was discoved and how to treat it.
- Write a paragraph explaining why WBDs are such a
problem around the world even though we know how to treat/prevent them.
CHAPTER 18 QUESTIONS
1. The most common source(s) of SALMONELLOSIS infections is/are:
A. Fish
B. Human, particularly babies
C. Wild birds
D. House hold pets like, cats & dogs
E. Domestic animals like chickens, turkeys, & cattle.
2.The most common source(s) of hepatitis A infections of humans is fecal
material from:
A. Fish
B. Humans
C. Wild birds
D. Household pets like, cats & dogs
E. Domestic animals like chickens, turkeys, & cattle.
3. HELICOBACTER PYLORI infections have proven to be the major cause of:
A. Cholera
B. Ulcers (stomach)
C. Lung cancer
D. Hepatitis A
E. Traveler’s diarrhea.
4. Historically, CHOLERA infections were:
A. A more important cause of death among the pioneers than Indians.
B. Responsible for the Germans losing the first world war.
C. A minor problem in man’s history.
D. Mainly a disease of domestic animals.
E. A major cause of death of Americans in the second world war.
5. The process of canning was discovered by?
A. Edward Jenner
B. L. Pasteur.
C. R. Koch
D. Mullis
E. Appert
6. Pasteurization preserves food by:
A. Killing the pathogens and generally decreasing the total numbers of microbes in a
food.
B. By sterilizing the food.
C. By killing Clostridium botulinum spores.
D. By drying out the food to the point where nothing can grow.
E. By forming bacterial inhibiting chemicals in the heated foods.
7. Salting, pickling and the use of high concentrations of sugar all preserve food by:
A. By lowering the pH (making the food more acidic).
B. By raising the pH (making the food more alkaline).
C. Binding the free water so that microbes can’t get enough to grow.
D. By inducing the formation of inhibitory chemicals in the foods.
E. .By increasing the efficacy of the action of antibiotics added to the food.
8. Organic acids, like vinegar and lactic acid, preserve foods by:
A. By lowering the pH (making the food more acidic).
B. By raising the pH (making the food more alkaline).
C. Binding the free water so that microbes can’t get enough to grow.
D. By inducing the formation of inhibitory chemicals in the foods.
E. .By increasing the efficacy of the action of antibiotics added to the food.
9. Smoking preserves food by: If only ONE of A, B, & C are correct chose it,
otherwise choose D or E.
A. By lowering the pH (making the food more acidic).
B. By inducing the formation of inhibitory chemicals in the foods.
C. Binding the free water so that microbes can’t get enough to grow.
D. By B & C only
E. By A, B, & C.
10. Which of the following common food preservatives are carcinogenic? If only ONE
of A, B, & C are correct chose it, otherwise choose D or E.
A. Nitrite
B. Aldehydes
C. Sulfite
D. A & B
E. A & C
Click here for the answers to these
questions.
CHAPTER 18 ESSAY QUESTIONS
- Discuss how social attitudes affect how we view the things we call "food" and
give some examples to illustrate your points.
- Explain why the spice trade was so important to the people of the time.
- Describe each of the 11 forms of food preservation discussed in the chapter. Tell how
each works and give some example of their use. Discuss advantages and disadvantages of
each. Write a paragraph on the pros and cons of using radiation to sterilize food.
- Discuss the 4 common gaps in knowledge about food borne disease.
- Discuss the TWO categories of food borne disease and give two examples of each.
- Describe each of the 8 food borne diseases discussed in the NetText. Tell the organism
involved (scientific name where applicable), the characteristics of each disease state,
the source(s) of infection, unusually characteristics about the disease, organism etc.
- List the 6 ways to protect yourself and your family from food borne disease in the home
and discuss the final one in detail.
- How can microwave ovens be a problem with regard to food borne disease?
CHAPTER 19 QUESTIONS
CHAPTER 19 ESSAY QUESTIONS
- Describe the process of making cheese from milk. Tell what is added
(besides milk) at each step and its purpose. Also discuss why there are so many different
cheeses. Discuss the waste products of cheese manufacturing.
- Describe the process of making beer. Tell what is added at each step and
its purpose. Also discuss why there are so many different beers. Discuss the waste
products of cheese manufacturing. Explain why beer and alcohol are called "yeast
pee". What happens to beer when oxygen is present? List and define the "special
terms" used in discussing/describing beer.
- Describe the process of making bread. Tell what is added at each step and
its purpose.
- What is silage and how is it made?
- Explain/describe the microbial events that led to the founding of Israel.
Name the scientist involved.
- Describe the general process of "industrial fermentation".
- Who discovered "penicillin" and what else did he discover. Why
was he called a "character"?
- Explain exactly what a "BIOTECH INDUSTRY" is and name 3
produces produced by these industries.
- Define "bioremediation" and explain the roll of microbes in it.
Also explain the "enrichment or elective culture process" and describe how it
relates to evolutionary processes.
- Why are "toxic waste dumps" such a problem?
Click here for the answers to these
questions.
CHAPTER 20 QUESTIONS
CHAPTER 20 ESSAY QUESTIONS
- Define "man-made chemicals" as used in this chapter.
- Discuss this statement: "there is probably no human endeavor in
which microbes fail to play a role in at some level".
- Discuss what is met by the term "microenvironment or
microhabitat". Describe an example to illustrate your explanation.
- Describe (name) the various types of symbioses discussed in this chapter.
- What is met by the term: "nutrient cycle". Name 3 such cycles
and describe at least one in some detail.
- How do methane and carbon dioxide affect "global warming"?
- Describe the relationship between a cow and the microbes it depends on.
- What are the Rhizobia and what do they do that is so very important to
our world; describe where you would go to isolate them quickly.
Click here for the answers to these
questions.
Click Here
for for a full exam #4 on Chapters 18-21. When
the site opens up type your name in the "User ID: box"; In the "test
ID" box type: Self
Test 4
STUDENT PREPARED SELF ASSESSMENT EXAMS
Student Extra Credit Exam for Chapters 18-21
E-mail questions and comments to
to
get answers to the questions.
Copyright © Dr. R. E. Hurlbert, 1998. This
material may be used for educational purposes only and may not be duplicated for
commercial purposes.
SCIENCE HALL, ROOM 440CA
PHONE: 509-335-5108
FAX: 509-335-1907
E-mail address: or hurlbert@pullman.com
TOC